Predicting brain metastasis in early stage non-small cell lung cancer patients by gene expression profiling

Background: Non-small cell lung cancer (NSCLC) is the most common cause of cancer-deaths due to early metastatic spread, in many cases, especially to the brain. The pattern of the spread of disease-specific organ may be driven by the activity of specific signaling pathway in the primary tumor. We aim to identify gene expression signatures and the relevant signal associated with the development of brain metastasis (BM) after surgical resection of NSCLC.


Methods: frozen Fast NSCLC surgical specimens obtained from the tumor bank. RNA was extracted and analyzed by RNA-sequencing (Illumina HiSeq 2500). clinical parameters and gene expression examined to distinguish between patients with BM, patients with metastasis to sites other than the brain, and patients who do not develop metastatic disease in a significant clinical follow-up. Study component analysis and principal enrichment lines do.


Results: A total of 91 patients were included in this study, 32 of which were developed BM. The stage of disease at diagnosis (P = 0.004) and the degree of differentiation (P = 0.007) were significantly different between BM and control groups. We identified a set of 22 genes that are associated specifically with the BM, and not with metastasis to other sites. This sets reached 93.4% accuracy (95% CI: 86.2 to 97.5%), 96.6% specificity and 87.5% sensitivity of identifying the correct patient BM in the analysis of the internal validation leave-one-out , The oxidative phosphorylation pathway was highly correlated with the risk of BM.


Conclusion:
The expression level of a small set of genes from the primary tumor was found to predict the development of BM, clear of metastasis to other organs. Oxidative phosphorylation correlated genes and pathways require further validation as a useful predictor of the clinical potential of BM and perhaps as a new therapeutic target for the prevention of BM.

Predicting brain metastasis in early stage non-small cell lung cancer patients by gene expression profiling
Predicting brain metastasis in early stage non-small cell lung cancer patients by gene expression profiling

Gene expression profile identifies Zac1 role in metastatic cervical cancer

Zinc-finger proteins that regulate apoptosis and cell cycle arrest 1 (Zac1), encoded by the gene Plagl1, is a transcription factor of seven zinc-finger-containing belong printed genome and is expressed in various types of human embryonic and adult tissue. Zac1 is postulated be a tumor suppressor by inducing cell cycle arrest and apoptosis through interacting and modulating the transcriptional activity of p53 as named.

Correspondingly, reduction or loss of expression Zac1 associated with the occurrence and development of some human tumors, including cervical cancer, breast cancer, ovarian cancer, pituitary tumors and basal cell carcinoma, implying rationality of utilizing the expression Zac1 as a biomarker novel for evaluating the prognosis of cervical cancer.

However, until now, has not been clarified whether Zac1 expression associated with the prognosis of patients in clinical cervical cancer tumor samples. To answer the questions outlined above, we report here a comprehensive investigation Zac1 expression in biopsies of cervical carcinoma clinical. By analyzing the expression Zac1 in a variety of gene expression profiling of cervical cancer database, we demonstrated an association between high Zac1 expression and poor prognosis of cervical cancer.

RUSC1 Polyclonal Antibody

A60750 100 µg
EUR 570.55
Description: Ask the seller for details

RUSC1 Rabbit pAb

A15417-100ul 100 ul
EUR 308

RUSC1 Rabbit pAb

A15417-200ul 200 ul
EUR 459

RUSC1 Rabbit pAb

A15417-20ul 20 ul
EUR 183

RUSC1 Rabbit pAb

A15417-50ul 50 ul
EUR 223

RUSC1 Polyclonal Conjugated Antibody

C28956 100ul
EUR 397

RUSC1 Antibody

24975-100ul 100ul
EUR 390

RUSC1 antibody

70R-20048 50 ul
EUR 435
Description: Rabbit polyclonal RUSC1 antibody

RUSC1 Antibody

1-CSB-PA871585LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RUSC1. Recognizes RUSC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RUSC1 Antibody

1-CSB-PA020596GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RUSC1. Recognizes RUSC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RUSC1 Polyclonal Antibody, Biotin Conjugated

A60751 100 µg
EUR 570.55
Description: The best epigenetics products

RUSC1 Polyclonal Antibody, FITC Conjugated

A60752 100 µg
EUR 570.55
Description: kits suitable for this type of research

RUSC1 Polyclonal Antibody, HRP Conjugated

A60753 100 µg
EUR 570.55
Description: fast delivery possible

RUSC1 Antibody (HRP)

20-abx311097
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RUSC1 Antibody (FITC)

20-abx311098
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RUSC1 Antibody (Biotin)

20-abx311099
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-RUSC1 antibody

STJ117612 100 µl
EUR 277

RUSC1 siRNA

20-abx932297
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RUSC1 siRNA

20-abx932298
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RUSC1

YF-PA17995 50 ul
EUR 363
Description: Mouse polyclonal to RUSC1

anti-RUSC1

YF-PA17996 50 ug
EUR 363
Description: Mouse polyclonal to RUSC1

RUSC1 Antibody, HRP conjugated

1-CSB-PA871585LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RUSC1. Recognizes RUSC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RUSC1 Antibody, FITC conjugated

1-CSB-PA871585LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RUSC1. Recognizes RUSC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RUSC1 Antibody, Biotin conjugated

1-CSB-PA871585LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RUSC1. Recognizes RUSC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RUSC1 cloning plasmid

CSB-CL871585HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atggcagaagcccagagtgggactggtcagctgcaggagcagaagaaaggtcttctgatagccgtcagcgtctccgttgataaaatcatctcgcatttcggggccgcccggaacttggtgcagaaggcccagttgggtgatagccggctgagcccggatgtggggcacctggtgc
  • Show more
Description: A cloning plasmid for the RUSC1 gene.

RUSC1-AS1 siRNA

20-abx932296
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Mouse RUSC1 shRNA Plasmid

20-abx977730
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RUSC1 shRNA Plasmid

20-abx958403
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RUSC1-AS1 ELISA KIT

ELI-15671h 96 Tests
EUR 824

Human RUSC1-AS1 shRNA Plasmid

20-abx967045
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RUSC1 ORF Vector (Human) (pORF)

ORF009143 1.0 ug DNA
EUR 95

Rusc1 ORF Vector (Mouse) (pORF)

ORF056564 1.0 ug DNA
EUR 506

Rusc1 ORF Vector (Mouse) (pORF)

ORF056565 1.0 ug DNA
EUR 506

Rusc1 ORF Vector (Mouse) (pORF)

ORF056566 1.0 ug DNA
EUR 506

Rusc1 sgRNA CRISPR Lentivector set (Mouse)

K3519901 3 x 1.0 ug
EUR 339

RUSC1 sgRNA CRISPR Lentivector set (Human)

K2078901 3 x 1.0 ug
EUR 339

RUSC1-AS1 ORF Vector (Human) (pORF)

ORF031887 1.0 ug DNA Ask for price

RUN And SH3 Domain-Containing Protein 1 (RUSC1) Antibody

abx122233-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RUN And SH3 Domain-Containing Protein 1 (RUSC1) Antibody

20-abx301679
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rusc1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3519902 1.0 ug DNA
EUR 154

Rusc1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3519903 1.0 ug DNA
EUR 154

Rusc1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3519904 1.0 ug DNA
EUR 154

RUSC1-AS1 sgRNA CRISPR Lentivector set (Human)

K2800401 3 x 1.0 ug
EUR 339

RUSC1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2078902 1.0 ug DNA
EUR 154

RUSC1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2078903 1.0 ug DNA
EUR 154

RUSC1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2078904 1.0 ug DNA
EUR 154

RUSC1 Protein Vector (Mouse) (pPB-C-His)

PV226254 500 ng
EUR 603

RUSC1 Protein Vector (Mouse) (pPB-N-His)

PV226255 500 ng
EUR 603

RUSC1 Protein Vector (Mouse) (pPM-C-HA)

PV226256 500 ng
EUR 603

RUSC1 Protein Vector (Mouse) (pPM-C-His)

PV226257 500 ng
EUR 603

RUSC1 Protein Vector (Mouse) (pPB-C-His)

PV226258 500 ng
EUR 1065

RUSC1 Protein Vector (Mouse) (pPB-N-His)

PV226259 500 ng
EUR 1065

RUSC1 Protein Vector (Mouse) (pPM-C-HA)

PV226260 500 ng
EUR 1065

RUSC1 Protein Vector (Mouse) (pPM-C-His)

PV226261 500 ng
EUR 1065

RUSC1 Protein Vector (Mouse) (pPB-C-His)

PV226262 500 ng
EUR 1065

RUSC1 Protein Vector (Mouse) (pPB-N-His)

PV226263 500 ng
EUR 1065

RUSC1 Protein Vector (Mouse) (pPM-C-HA)

PV226264 500 ng
EUR 1065

RUSC1 Protein Vector (Mouse) (pPM-C-His)

PV226265 500 ng
EUR 1065

RUSC1 Protein Vector (Human) (pPB-C-His)

PV036569 500 ng
EUR 329

RUSC1 Protein Vector (Human) (pPB-N-His)

PV036570 500 ng
EUR 329

RUSC1 Protein Vector (Human) (pPM-C-HA)

PV036571 500 ng
EUR 329

RUSC1 Protein Vector (Human) (pPM-C-His)

PV036572 500 ng
EUR 329

Rusc1 3'UTR Luciferase Stable Cell Line

TU118264 1.0 ml Ask for price

Rusc1 3'UTR GFP Stable Cell Line

TU168264 1.0 ml Ask for price

RUSC1 3'UTR GFP Stable Cell Line

TU072485 1.0 ml
EUR 1394

RUSC1 3'UTR Luciferase Stable Cell Line

TU022485 1.0 ml
EUR 1394

RUSC1-AS1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2800402 1.0 ug DNA
EUR 154

RUSC1-AS1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2800403 1.0 ug DNA
EUR 154

RUSC1-AS1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2800404 1.0 ug DNA
EUR 154

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Functional enrichment analysis showed that expression of high Zac1 associated with epithelial-mesenchymal transition (EMT), which was subsequently observed in clinical characteristics and metastatic carcinoma samples using immunohistochemical staining. Correspondingly, hypomethylation CpG islands in the promoter Zac1 observed in samples with high Zac1 expression in cervical carcinoma.