Faah Antibody Rabbit

Lab Reagents

Human IgG antibody Laboratories manufactures the faah antibody rabbit reagents distributed by Genprice. The Faah Antibody Rabbit reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact rabbit Antibody. Other Faah products are available in stock. Specificity: Faah Category: Antibody Group: Rabbit

Rabbit information

FAAH Antibody

ABD6308 100 ug
EUR 438

FAAH Conjugated Antibody

C32203 100ul
EUR 397

anti- FAAH antibody

FNab02927 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: fatty acid amide hydrolase
  • Uniprot ID: O00519
  • Gene ID: 2166
  • Research Area: Metabolism
Description: Antibody raised against FAAH

Anti-FAAH antibody

PAab02927 100 ug
EUR 355

Anti-FAAH antibody

STJ23602 100 µl
EUR 277
Description: This gene encodes a protein that is responsible for the hydrolysis of a number of primary and secondary fatty acid amides, including the neuromodulatory compounds anandamide and oleamide.

FAAH siRNA

20-abx901813
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FAAH siRNA

20-abx915899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FAAH siRNA

20-abx915900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FAAH Antibody, HRP conjugated

1-CSB-PA007938LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAAH. Recognizes FAAH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FAAH Antibody, FITC conjugated

1-CSB-PA007938LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAAH. Recognizes FAAH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FAAH Antibody, Biotin conjugated

1-CSB-PA007938LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAAH. Recognizes FAAH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FAAH Blocking Peptide

DF6308-BP 1mg
EUR 195

FAAH cloning plasmid

CSB-CL007938HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1740
  • Sequence: ATGGTGCAGTACGAGCTGTGGGCCGCGCTGCCTGGCGCCTCCGGGGTCGCCCTGGCCTGCTGCTTCGTGGCGGCGGCCGTGGCCCTGCGCTGGTCCGGGCGCCGGACGGCGCGGGGCGCGGTGGTCCGGGCGCGACAGAGGCAGCGAGCGGGCCTGGAGAACATGGACAGGGCGG
  • Show more
Description: A cloning plasmid for the FAAH gene.

FAAH-IN-2

HY-79511 5g
EUR 298

FAAH inhibitor 1

HY-10862 5mg
EUR 327

Polyclonal FAAH Antibody (C-Terminus)

AMM04468G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FAAH (C-Terminus). This antibody is tested and proven to work in the following applications:

Fatty Acid Amide Hydrolase (FAAH) Antibody

20-abx141594
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.